plko 1 scramble shrna shctrl Search Results


96
Addgene inc plko 1 shctr vector
Plko 1 Shctr Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko 1 shctr vector/product/Addgene inc
Average 96 stars, based on 1 article reviews
plko 1 shctr vector - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

94
Addgene inc plko 1 shcontrol shctrl
Plko 1 Shcontrol Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko 1 shcontrol shctrl/product/Addgene inc
Average 94 stars, based on 1 article reviews
plko 1 shcontrol shctrl - by Bioz Stars, 2026-05
94/100 stars
  Buy from Supplier

93
Addgene inc plko 1 shctrl shplac8
Plko 1 Shctrl Shplac8, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko 1 shctrl shplac8/product/Addgene inc
Average 93 stars, based on 1 article reviews
plko 1 shctrl shplac8 - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

98
Addgene inc plko 1 shctrl
Plko 1 Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko 1 shctrl/product/Addgene inc
Average 98 stars, based on 1 article reviews
plko 1 shctrl - by Bioz Stars, 2026-05
98/100 stars
  Buy from Supplier

96
Addgene inc plko 1 puro control shctrl
Plko 1 Puro Control Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko 1 puro control shctrl/product/Addgene inc
Average 96 stars, based on 1 article reviews
plko 1 puro control shctrl - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

96
Addgene inc plko 1 shctrl puro
Plko 1 Shctrl Puro, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko 1 shctrl puro/product/Addgene inc
Average 96 stars, based on 1 article reviews
plko 1 shctrl puro - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

95
Addgene inc control shrna against luciferase shctrl
Validation of expression and tumorigenicity of hub genes. (A) qRT-PCR validation of MEP1A, CCL20, ADORA2B, TNFSF9, ICAM4, and SLC7A2 in HCC and normal plasmas. (B, C) The mRNA expression level of CCL20 and SLC7A2 in HCC cell lines (SMMC7721, Huh7, HepG2, and HCCLM3) and the normal liver cell lines (WLR68, and LO2) was indicated by qRT-PCR assays. (D) The protein and (E) mRNA expression of CCL20 and SLC7A2 was analyzed by western blotting and RT-PCR in stable SMMC-7721 cells expressing-shRNA against <t>luciferase</t> or CCL20 and over SLC7A2. (F) Morphology of HCC cells after knockdown of CCL20 and overexpression of SLC7A2. (G) Tumorigenicity of <t>SMMC7721-shCtrl</t> cells and SMMC7721-shCCL20/overSLC7A2 cells in nude mice. (H) Tumor volume was measured every 3 days after tumor formation in nude mice injected with SMMC7721 cells transfected with shCtrl or shCCL20/overSLC7A2. (I, J) Tumor weight was measured in nude mice injected with SMMC7721 cells transfected with shCtrl or shCCL20/overSLC7A2 after 30 days. *p < 0.05; **p < 0.01; ***p < 0.005; ****p < 0.0001, ns, not significant.
Control Shrna Against Luciferase Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/control shrna against luciferase shctrl/product/Addgene inc
Average 95 stars, based on 1 article reviews
control shrna against luciferase shctrl - by Bioz Stars, 2026-05
95/100 stars
  Buy from Supplier

93
Addgene inc plko 1 shctrl puro target sequence 5 cctaaggttaagtcgccctcg 3
Validation of expression and tumorigenicity of hub genes. (A) qRT-PCR validation of MEP1A, CCL20, ADORA2B, TNFSF9, ICAM4, and SLC7A2 in HCC and normal plasmas. (B, C) The mRNA expression level of CCL20 and SLC7A2 in HCC cell lines (SMMC7721, Huh7, HepG2, and HCCLM3) and the normal liver cell lines (WLR68, and LO2) was indicated by qRT-PCR assays. (D) The protein and (E) mRNA expression of CCL20 and SLC7A2 was analyzed by western blotting and RT-PCR in stable SMMC-7721 cells expressing-shRNA against <t>luciferase</t> or CCL20 and over SLC7A2. (F) Morphology of HCC cells after knockdown of CCL20 and overexpression of SLC7A2. (G) Tumorigenicity of <t>SMMC7721-shCtrl</t> cells and SMMC7721-shCCL20/overSLC7A2 cells in nude mice. (H) Tumor volume was measured every 3 days after tumor formation in nude mice injected with SMMC7721 cells transfected with shCtrl or shCCL20/overSLC7A2. (I, J) Tumor weight was measured in nude mice injected with SMMC7721 cells transfected with shCtrl or shCCL20/overSLC7A2 after 30 days. *p < 0.05; **p < 0.01; ***p < 0.005; ****p < 0.0001, ns, not significant.
Plko 1 Shctrl Puro Target Sequence 5 Cctaaggttaagtcgccctcg 3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko 1 shctrl puro target sequence 5 cctaaggttaagtcgccctcg 3/product/Addgene inc
Average 93 stars, based on 1 article reviews
plko 1 shctrl puro target sequence 5 cctaaggttaagtcgccctcg 3 - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

90
Shanghai GenePharma lentiviral vectors plko.1
Validation of expression and tumorigenicity of hub genes. (A) qRT-PCR validation of MEP1A, CCL20, ADORA2B, TNFSF9, ICAM4, and SLC7A2 in HCC and normal plasmas. (B, C) The mRNA expression level of CCL20 and SLC7A2 in HCC cell lines (SMMC7721, Huh7, HepG2, and HCCLM3) and the normal liver cell lines (WLR68, and LO2) was indicated by qRT-PCR assays. (D) The protein and (E) mRNA expression of CCL20 and SLC7A2 was analyzed by western blotting and RT-PCR in stable SMMC-7721 cells expressing-shRNA against <t>luciferase</t> or CCL20 and over SLC7A2. (F) Morphology of HCC cells after knockdown of CCL20 and overexpression of SLC7A2. (G) Tumorigenicity of <t>SMMC7721-shCtrl</t> cells and SMMC7721-shCCL20/overSLC7A2 cells in nude mice. (H) Tumor volume was measured every 3 days after tumor formation in nude mice injected with SMMC7721 cells transfected with shCtrl or shCCL20/overSLC7A2. (I, J) Tumor weight was measured in nude mice injected with SMMC7721 cells transfected with shCtrl or shCCL20/overSLC7A2 after 30 days. *p < 0.05; **p < 0.01; ***p < 0.005; ****p < 0.0001, ns, not significant.
Lentiviral Vectors Plko.1, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lentiviral vectors plko.1/product/Shanghai GenePharma
Average 90 stars, based on 1 article reviews
lentiviral vectors plko.1 - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

92
Addgene inc plko 1 scramble shrna shctrl
Validation of expression and tumorigenicity of hub genes. (A) qRT-PCR validation of MEP1A, CCL20, ADORA2B, TNFSF9, ICAM4, and SLC7A2 in HCC and normal plasmas. (B, C) The mRNA expression level of CCL20 and SLC7A2 in HCC cell lines (SMMC7721, Huh7, HepG2, and HCCLM3) and the normal liver cell lines (WLR68, and LO2) was indicated by qRT-PCR assays. (D) The protein and (E) mRNA expression of CCL20 and SLC7A2 was analyzed by western blotting and RT-PCR in stable SMMC-7721 cells expressing-shRNA against <t>luciferase</t> or CCL20 and over SLC7A2. (F) Morphology of HCC cells after knockdown of CCL20 and overexpression of SLC7A2. (G) Tumorigenicity of <t>SMMC7721-shCtrl</t> cells and SMMC7721-shCCL20/overSLC7A2 cells in nude mice. (H) Tumor volume was measured every 3 days after tumor formation in nude mice injected with SMMC7721 cells transfected with shCtrl or shCCL20/overSLC7A2. (I, J) Tumor weight was measured in nude mice injected with SMMC7721 cells transfected with shCtrl or shCCL20/overSLC7A2 after 30 days. *p < 0.05; **p < 0.01; ***p < 0.005; ****p < 0.0001, ns, not significant.
Plko 1 Scramble Shrna Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko 1 scramble shrna shctrl/product/Addgene inc
Average 92 stars, based on 1 article reviews
plko 1 scramble shrna shctrl - by Bioz Stars, 2026-05
92/100 stars
  Buy from Supplier

Image Search Results


Validation of expression and tumorigenicity of hub genes. (A) qRT-PCR validation of MEP1A, CCL20, ADORA2B, TNFSF9, ICAM4, and SLC7A2 in HCC and normal plasmas. (B, C) The mRNA expression level of CCL20 and SLC7A2 in HCC cell lines (SMMC7721, Huh7, HepG2, and HCCLM3) and the normal liver cell lines (WLR68, and LO2) was indicated by qRT-PCR assays. (D) The protein and (E) mRNA expression of CCL20 and SLC7A2 was analyzed by western blotting and RT-PCR in stable SMMC-7721 cells expressing-shRNA against luciferase or CCL20 and over SLC7A2. (F) Morphology of HCC cells after knockdown of CCL20 and overexpression of SLC7A2. (G) Tumorigenicity of SMMC7721-shCtrl cells and SMMC7721-shCCL20/overSLC7A2 cells in nude mice. (H) Tumor volume was measured every 3 days after tumor formation in nude mice injected with SMMC7721 cells transfected with shCtrl or shCCL20/overSLC7A2. (I, J) Tumor weight was measured in nude mice injected with SMMC7721 cells transfected with shCtrl or shCCL20/overSLC7A2 after 30 days. *p < 0.05; **p < 0.01; ***p < 0.005; ****p < 0.0001, ns, not significant.

Journal: Frontiers in Oncology

Article Title: An inflammation-related gene landscape predicts prognosis and response to immunotherapy in virus-associated hepatocellular carcinoma

doi: 10.3389/fonc.2023.1118152

Figure Lengend Snippet: Validation of expression and tumorigenicity of hub genes. (A) qRT-PCR validation of MEP1A, CCL20, ADORA2B, TNFSF9, ICAM4, and SLC7A2 in HCC and normal plasmas. (B, C) The mRNA expression level of CCL20 and SLC7A2 in HCC cell lines (SMMC7721, Huh7, HepG2, and HCCLM3) and the normal liver cell lines (WLR68, and LO2) was indicated by qRT-PCR assays. (D) The protein and (E) mRNA expression of CCL20 and SLC7A2 was analyzed by western blotting and RT-PCR in stable SMMC-7721 cells expressing-shRNA against luciferase or CCL20 and over SLC7A2. (F) Morphology of HCC cells after knockdown of CCL20 and overexpression of SLC7A2. (G) Tumorigenicity of SMMC7721-shCtrl cells and SMMC7721-shCCL20/overSLC7A2 cells in nude mice. (H) Tumor volume was measured every 3 days after tumor formation in nude mice injected with SMMC7721 cells transfected with shCtrl or shCCL20/overSLC7A2. (I, J) Tumor weight was measured in nude mice injected with SMMC7721 cells transfected with shCtrl or shCCL20/overSLC7A2 after 30 days. *p < 0.05; **p < 0.01; ***p < 0.005; ****p < 0.0001, ns, not significant.

Article Snippet: Full-length SLC7A2 cDNA was synthesized and cloned into the pCS-CG vector (Addgene, Cambridge, MA, USA). shRNA sequences specifically against CCL20 (shCCL20) and control-shRNA against luciferase (shCtrl) were expressed from pLKO.1-puro (Addgene, Cambridge, MA, USA).

Techniques: Biomarker Discovery, Expressing, Quantitative RT-PCR, Western Blot, Reverse Transcription Polymerase Chain Reaction, shRNA, Luciferase, Knockdown, Over Expression, Injection, Transfection